1. Flowchart of gRNA Design

2. Comparison with Other Tools

3. Input Preparation

4. Parameters Introduction
     4.1 Basic Options
     4.2 Advanced Options

5. Result Interpretation
     5.1 Running Information
     5.2a Result Table for pgRNA
     5.2b Result Table for sgRNA Pair

6. Search in Database

Input: GuideScan permits genomic region (chr1:38140090-38140189 in hg38), and the others take target sequence as input.
Target sequence:
>Optimized_CRISPR_Design_web
GGAGCTGCAGGGACCTCCATGTCCTGGGACTGTTTGTGCAGGGCTCCGAGGGGACCCATGTGGCTCAGGGTGGCTAAGGGGGCAATGCTGCCCCCACCCGCTGGATGAC

Comparison Result:

1) SSC designs 30bp sgRNA for scoring, thus missing the last sgRNA would appear in 20bp sgRNAs.
2) WGE outputs 28 lines. Actually 22 sgRNAs were remained after deleting the repeated sgRNAs.
3) OT: Off-targets.
4) GuideScan only provides the off-target information when mismatch is equal to 2 or 3.

pgRNAFinder accepts input in three formats by typing or uploading:

1) Genomic region (chr:start-end)
2) Gene name
3) Target sequence (fasta)

By clicking “genomic region”, “gene name” or “target sequence”, a corresponding example will be shown in the text box, which can be used to test this web tool.

4.1 Basic Options

gRNA Type: Paired Nickase, Paired gRNA, Single gRNA.
1) Genome: hg19, hg38, mm10, bosTau, canFam, danRer, galGal, ratNor, sacCer or susScr.
2) PAM sequence: NGG, NAG, NNGRRT, NNNNACA or self-definded sequence comprised of A,G,C,T,N,R.
3) On-Target: Exon or All
     Exon: At least one gRNA whose on-target site locates in exon region (recommended).
     All: Report all gRNAs.
4) SSC score cutoff: For evaluating gRNA efficiency, higher is better, 0.5 is recommended; -1~1 (may be a little lower than -1 or higher than 1).
5) Mismatch: Mismatch for Off-Spotter when finding off-targets.
6) Max Off-Targets: Off-targets located in genome.
7) Max OTs in Exon: Off-targets located in exon.

The following options are available only when "gRNA Type" is set to "Paired".
8) Strand: Same (two gRNAs are in the same stand), Diff (two gRNAs are in the different stand), Both.
9) Pair Distance: Distance between paired gRNA.
10) Coverage: Equal to distance between pgRNA divided by the length of sequence.

4.2 Advanced Options

Advanced options are hidden by default. Choose "Show" to show them.
1) Restriction Enzymes：No or GAGACC or GAGACC,GGTCTC or self-defined like e1,e2,...en. Guide RNAs containing with restriction enzyme site will be filtered out.
2) gRNA Length: The number of base in the upstream of PAM; at better >=20bp for off-target analysis.
3) Downstream Length: The number of base in the downstream of PAM.
4) CG Content.

After setting up the options, please click Submit to run the tool.

5.1 Running Information

As below. Step 5 is the most time consuming, which would take from minutes to hours depending on the workload, please wait patiently especially after you submit a lot of work. The hyperlink to your results will be sent to your mailbox.

5.2a Result Table for pgRNA

The result are provided in several different ways. You can also choose the columns you are interested to view, but it will not affect the file you export.

The explanation to each column:

More detailed explanations can be found in README.txt.

5.2b Result Table for sgRNA

The explanations are consistent with the "pgRNA" above.